Transcript: Mouse XM_006500946.2

PREDICTED: Mus musculus capping protein (actin filament) muscle Z-line, alpha 1 (Capza1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Capza1 (12340)
Length:
2746
CDS:
42..695

Additional Resources:

NCBI RefSeq record:
XM_006500946.2
NBCI Gene record:
Capza1 (12340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091461 GCCGCTAAATTCATCACCCAT pLKO.1 90 CDS 100% 2.640 3.696 N Capza1 n/a
2 TRCN0000091458 CCAGAGTTCTACTATGTTTAA pLKO.1 1822 3UTR 100% 13.200 9.240 N Capza1 n/a
3 TRCN0000116911 CCAGTATAACATGGATCAGTT pLKO.1 206 CDS 100% 4.950 3.465 N CAPZA1 n/a
4 TRCN0000091459 CTACTGCTTAACAATGACAAT pLKO.1 153 CDS 100% 4.950 3.465 N Capza1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05935 pDONR223 100% 61.5% 68.8% None (many diffs) n/a
2 ccsbBroad304_05935 pLX_304 0% 61.5% 68.8% V5 (many diffs) n/a
3 TRCN0000471892 AGTTACTATACTAATTTTAATAAG pLX_317 53.1% 61.5% 68.8% V5 (many diffs) n/a
Download CSV