Transcript: Mouse XM_006501001.2

PREDICTED: Mus musculus ganglioside-induced differentiation-associated-protein 2 (Gdap2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gdap2 (14547)
Length:
2993
CDS:
333..1829

Additional Resources:

NCBI RefSeq record:
XM_006501001.2
NBCI Gene record:
Gdap2 (14547)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175748 GCGGCAAATTAGAATCAGTGA pLKO.1 1088 CDS 100% 2.640 3.696 N Gdap2 n/a
2 TRCN0000328478 GCGGCAAATTAGAATCAGTGA pLKO_005 1088 CDS 100% 2.640 3.696 N Gdap2 n/a
3 TRCN0000173399 GCTCGGTTCATCATTCACACA pLKO.1 696 CDS 100% 2.640 2.112 N Gdap2 n/a
4 TRCN0000328274 GCTCGGTTCATCATTCACACA pLKO_005 696 CDS 100% 2.640 2.112 N Gdap2 n/a
5 TRCN0000175391 CGAGGTTATCCACTAGAAGAT pLKO.1 852 CDS 100% 4.950 3.465 N Gdap2 n/a
6 TRCN0000328346 CGAGGTTATCCACTAGAAGAT pLKO_005 852 CDS 100% 4.950 3.465 N Gdap2 n/a
7 TRCN0000175778 GACTCGTACGAAGATGAAGTA pLKO.1 393 CDS 100% 4.950 3.465 N Gdap2 n/a
8 TRCN0000328345 GACTCGTACGAAGATGAAGTA pLKO_005 393 CDS 100% 4.950 3.465 N Gdap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03465 pDONR223 100% 86.8% 92.4% None (many diffs) n/a
2 ccsbBroad304_03465 pLX_304 0% 86.8% 92.4% V5 (many diffs) n/a
3 TRCN0000474118 ACTGGCCACTTGAAGTTTGTTCGA pLX_317 28.5% 86.8% 92.4% V5 (many diffs) n/a
Download CSV