Transcript: Mouse XM_006501089.2

PREDICTED: Mus musculus myocyte enhancer factor 2D (Mef2d), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mef2d (17261)
Length:
5267
CDS:
282..1826

Additional Resources:

NCBI RefSeq record:
XM_006501089.2
NBCI Gene record:
Mef2d (17261)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310963 CAAAGGGTTAATGCATCATTT pLKO_005 1115 CDS 100% 13.200 18.480 N Mef2d n/a
2 TRCN0000085271 CAATGGCAACAGCCTAAACAA pLKO.1 995 CDS 100% 5.625 7.875 N Mef2d n/a
3 TRCN0000085269 GCGAATCACTGATGAACGGAA pLKO.1 308 CDS 100% 2.640 2.112 N Mef2d n/a
4 TRCN0000310965 GCTGGATACTTGGACATTAAA pLKO_005 1802 CDS 100% 15.000 10.500 N Mef2d n/a
5 TRCN0000304479 GTCCTGTTGATGGTTACATTT pLKO_005 1942 3UTR 100% 13.200 9.240 N Mef2d n/a
6 TRCN0000085270 CACATCAGCATCAAGTCAGAA pLKO.1 1563 CDS 100% 4.950 3.465 N Mef2d n/a
7 TRCN0000085268 GCACTACAGAGAAACAGTGTT pLKO.1 834 CDS 100% 4.950 3.465 N Mef2d n/a
8 TRCN0000315949 GCACTACAGAGAAACAGTGTT pLKO_005 834 CDS 100% 4.950 3.465 N Mef2d n/a
9 TRCN0000085272 CCCTGGTGACATCATCCCTTA pLKO.1 781 CDS 100% 4.050 2.835 N Mef2d n/a
10 TRCN0000349137 CCCTGGTGACATCATCCCTTA pLKO_005 781 CDS 100% 4.050 2.835 N Mef2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00997 pDONR223 100% 90.9% 95.9% None (many diffs) n/a
2 ccsbBroad304_00997 pLX_304 0% 90.9% 95.9% V5 (many diffs) n/a
3 TRCN0000478896 TCTCGTATATTATACATCGTACAC pLX_317 23.4% 90.9% 95.9% V5 (many diffs) n/a
Download CSV