Transcript: Mouse XM_006501100.1

PREDICTED: Mus musculus Moloney leukemia virus 10 (Mov10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mov10 (17454)
Length:
3605
CDS:
270..3284

Additional Resources:

NCBI RefSeq record:
XM_006501100.1
NBCI Gene record:
Mov10 (17454)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097833 GCAGCAATATCGGGTCTTAAT pLKO.1 2111 CDS 100% 13.200 18.480 N Mov10 n/a
2 TRCN0000326687 GCAGCAATATCGGGTCTTAAT pLKO_005 2111 CDS 100% 13.200 18.480 N Mov10 n/a
3 TRCN0000097832 GCTATGAACTAGAGCTAAGTT pLKO.1 1117 CDS 100% 5.625 7.875 N Mov10 n/a
4 TRCN0000326759 GCTATGAACTAGAGCTAAGTT pLKO_005 1117 CDS 100% 5.625 7.875 N Mov10 n/a
5 TRCN0000097831 CGCCTACAACTCCTTGTATAA pLKO.1 2393 CDS 100% 1.320 1.056 N Mov10 n/a
6 TRCN0000354123 CGCCTACAACTCCTTGTATAA pLKO_005 2393 CDS 100% 1.320 1.056 N Mov10 n/a
7 TRCN0000097830 CCAAGCCTTATTGCTGCCTAT pLKO.1 3314 3UTR 100% 4.050 2.835 N Mov10 n/a
8 TRCN0000326761 CCAAGCCTTATTGCTGCCTAT pLKO_005 3314 3UTR 100% 4.050 2.835 N Mov10 n/a
9 TRCN0000097834 CTCGCCTACAACTCCTTGTAT pLKO.1 2391 CDS 100% 0.563 0.394 N Mov10 n/a
10 TRCN0000049981 GCTGACCTTCAAGGTGAACTT pLKO.1 1592 CDS 100% 4.950 2.970 N MOV10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01030 pDONR223 100% 87.8% 91.1% None (many diffs) n/a
Download CSV