Transcript: Mouse XM_006501288.3

PREDICTED: Mus musculus Rho GTPase activating protein 29 (Arhgap29), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap29 (214137)
Length:
5167
CDS:
185..3985

Additional Resources:

NCBI RefSeq record:
XM_006501288.3
NBCI Gene record:
Arhgap29 (214137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023925 CCTCGACAACAAAGTACATTT pLKO.1 3106 CDS 100% 13.200 18.480 N Arhgap29 n/a
2 TRCN0000362047 GATACTACGTCTACCTATTTC pLKO_005 661 CDS 100% 13.200 18.480 N Arhgap29 n/a
3 TRCN0000023928 GCACGATTAGTAGAGTTCCTT pLKO.1 2804 CDS 100% 3.000 4.200 N Arhgap29 n/a
4 TRCN0000023924 CCATTGAAACATTGGCATTTA pLKO.1 588 CDS 100% 13.200 10.560 N Arhgap29 n/a
5 TRCN0000361989 CCAATTCCCTCGGAGCATTTA pLKO_005 1974 CDS 100% 13.200 9.240 N Arhgap29 n/a
6 TRCN0000362045 GGATGCACTTAGTAGACATTT pLKO_005 2364 CDS 100% 13.200 9.240 N Arhgap29 n/a
7 TRCN0000362046 TTGCCAGAGACCACGACTAAA pLKO_005 3913 CDS 100% 13.200 9.240 N Arhgap29 n/a
8 TRCN0000023926 CCAGGAGACTTTCATCGGAAA pLKO.1 1868 CDS 100% 4.050 2.835 N Arhgap29 n/a
9 TRCN0000023927 GCTGTGAACTTTACAGAAGTT pLKO.1 524 CDS 100% 0.495 0.347 N Arhgap29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14018 pDONR223 100% 26.8% 26.8% None (many diffs) n/a
2 ccsbBroad304_14018 pLX_304 0% 26.8% 26.8% V5 (many diffs) n/a
3 TRCN0000467083 CGCCGCCAACGAATGTACATCACT pLX_317 25.6% 26.8% 26.8% V5 (many diffs) n/a
Download CSV