Transcript: Mouse XM_006501305.3

PREDICTED: Mus musculus thyroid stimulating hormone, beta subunit (Tshb), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tshb (22094)
Length:
2186
CDS:
130..546

Additional Resources:

NCBI RefSeq record:
XM_006501305.3
NBCI Gene record:
Tshb (22094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089370 GTATTGTATGACACGGGATAT pLKO.1 276 CDS 100% 10.800 15.120 N Tshb n/a
2 TRCN0000089369 TGGCAAGTGTAATACTGACAA pLKO.1 444 CDS 100% 4.950 6.930 N Tshb n/a
3 TRCN0000089372 GAGTATACAATGTACGTGGAT pLKO.1 205 CDS 100% 2.640 3.696 N Tshb n/a
4 TRCN0000089368 CGCACCATGTTACTCCTTATT pLKO.1 392 CDS 100% 13.200 10.560 N Tshb n/a
5 TRCN0000424080 ATATCAATGGCAAACTGTTTC pLKO_005 293 CDS 100% 10.800 7.560 N TSHB n/a
6 TRCN0000089371 GCCCGCACCATGTTACTCCTT pLKO.1 389 CDS 100% 0.880 0.616 N Tshb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07103 pDONR223 100% 83.6% 85.5% None (many diffs) n/a
2 ccsbBroad304_07103 pLX_304 0% 83.6% 85.5% V5 (many diffs) n/a
3 TRCN0000467439 CGCAATAACCGCTACCACTGAGTG pLX_317 90.3% 83.6% 85.5% V5 (many diffs) n/a
Download CSV