Transcript: Mouse XM_006501361.2

PREDICTED: Mus musculus GATA zinc finger domain containing 2B (Gatad2b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gatad2b (229542)
Length:
7329
CDS:
142..1926

Additional Resources:

NCBI RefSeq record:
XM_006501361.2
NBCI Gene record:
Gatad2b (229542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230882 CTGATTGCATCAGCATATATA pLKO_005 5966 3UTR 100% 15.000 21.000 N GATAD2B n/a
2 TRCN0000230881 TTGATGTCTCAACGTGTTATT pLKO_005 922 CDS 100% 13.200 18.480 N GATAD2B n/a
3 TRCN0000124837 GCCGCATGAGTTACCTACTAA pLKO.1 318 CDS 100% 5.625 7.875 N Gatad2b n/a
4 TRCN0000327198 GCCGCATGAGTTACCTACTAA pLKO_005 318 CDS 100% 5.625 7.875 N Gatad2b n/a
5 TRCN0000124836 TCAACGTGTTATTGCACCAAA pLKO.1 930 CDS 100% 4.950 6.930 N Gatad2b n/a
6 TRCN0000327197 TCAACGTGTTATTGCACCAAA pLKO_005 930 CDS 100% 4.950 6.930 N Gatad2b n/a
7 TRCN0000218125 AGGAAATTGAACAGCGATTAC pLKO_005 1562 CDS 100% 10.800 8.640 N GATAD2B n/a
8 TRCN0000015317 CAGGAAATTGAACAGCGATTA pLKO.1 1561 CDS 100% 10.800 7.560 N GATAD2B n/a
9 TRCN0000124835 CGGATGGAAGAGAGACTCAAA pLKO.1 565 CDS 100% 4.950 3.465 N Gatad2b n/a
10 TRCN0000327270 CGGATGGAAGAGAGACTCAAA pLKO_005 565 CDS 100% 4.950 3.465 N Gatad2b n/a
11 TRCN0000124834 GCCAGGTGTCAACATTGCATA pLKO.1 1788 CDS 100% 4.950 3.465 N Gatad2b n/a
12 TRCN0000327272 GCCAGGTGTCAACATTGCATA pLKO_005 1788 CDS 100% 4.950 3.465 N Gatad2b n/a
13 TRCN0000124838 ACAGGAAATTGAACAGCGATT pLKO.1 1560 CDS 100% 4.050 2.835 N Gatad2b n/a
14 TRCN0000363543 ACAGGAAATTGAACAGCGATT pLKO_005 1560 CDS 100% 4.050 2.835 N Gatad2b n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3635 3UTR 100% 4.950 2.475 Y KAAG1 n/a
16 TRCN0000015316 CCATCTATATGAACCTTGCTT pLKO.1 1088 CDS 100% 3.000 2.400 N GATAD2B n/a
17 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 3639 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03822 pDONR223 100% 92.8% 98.3% None (many diffs) n/a
2 ccsbBroad304_03822 pLX_304 0% 92.8% 98.3% V5 (many diffs) n/a
3 TRCN0000477048 CTCTTTCTGGGGTGAGCAGCATGT pLX_317 26.6% 92.8% 98.3% V5 (many diffs) n/a
Download CSV