Transcript: Mouse XM_006501397.1

PREDICTED: Mus musculus cold shock domain containing E1, RNA binding (Csde1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csde1 (229663)
Length:
4460
CDS:
673..3207

Additional Resources:

NCBI RefSeq record:
XM_006501397.1
NBCI Gene record:
Csde1 (229663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276864 GCGCCTTATAGTGTCAATTTA pLKO_005 3439 3UTR 100% 15.000 21.000 N Csde1 n/a
2 TRCN0000276866 TGCTGTAAGTGCTCGTAATAT pLKO_005 1317 CDS 100% 15.000 21.000 N Csde1 n/a
3 TRCN0000337493 GTGCTGTAAGTGCTCGTAATA pLKO_005 1316 CDS 100% 13.200 18.480 N Csde1 n/a
4 TRCN0000181609 GACCAGATAACTCAATGGGAT pLKO.1 3143 CDS 100% 2.640 3.696 N Csde1 n/a
5 TRCN0000319938 GACCAGATAACTCAATGGGAT pLKO_005 3143 CDS 100% 2.640 3.696 N Csde1 n/a
6 TRCN0000369329 TGCAACAGATGTCAGACTATT pLKO_005 1533 CDS 100% 13.200 10.560 N CSDE1 n/a
7 TRCN0000182514 CCCTGTTCAATACAGGCACTT pLKO.1 4124 3UTR 100% 0.405 0.324 N Csde1 n/a
8 TRCN0000198576 GAAGAACGAATGAACGGACAA pLKO.1 1099 CDS 100% 4.050 2.835 N Csde1 n/a
9 TRCN0000297097 GAAGAACGAATGAACGGACAA pLKO_005 1099 CDS 100% 4.050 2.835 N Csde1 n/a
10 TRCN0000181610 GCAGAAAGAAAGATCCGTCAA pLKO.1 3169 CDS 100% 4.050 2.835 N Csde1 n/a
11 TRCN0000276865 GCAGAAAGAAAGATCCGTCAA pLKO_005 3169 CDS 100% 4.050 2.835 N Csde1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.