Transcript: Mouse XM_006501406.2

PREDICTED: Mus musculus solute carrier family 6 (neurotransmitter transporter), member 17 (Slc6a17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc6a17 (229706)
Length:
6294
CDS:
478..2661

Additional Resources:

NCBI RefSeq record:
XM_006501406.2
NBCI Gene record:
Slc6a17 (229706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079736 CCAGCCGTATCGATTCTATTT pLKO.1 2163 CDS 100% 13.200 18.480 N Slc6a17 n/a
2 TRCN0000079734 CCTCTGGAAAGGTAATGTATT pLKO.1 1220 CDS 100% 13.200 9.240 N Slc6a17 n/a
3 TRCN0000079735 GCTACAACAAACAGGACAATA pLKO.1 1439 CDS 100% 13.200 9.240 N Slc6a17 n/a
4 TRCN0000079737 GCCGTATCGATTCTATTTCTA pLKO.1 2166 CDS 100% 5.625 3.938 N Slc6a17 n/a
5 TRCN0000079733 GCCATCTCTTATTCCTCAGTT pLKO.1 4365 3UTR 100% 4.950 3.465 N Slc6a17 n/a
6 TRCN0000038516 GTGGTCGAGAATGCTGAGAAA pLKO.1 1576 CDS 100% 4.950 3.465 N SLC6A17 n/a
7 TRCN0000038518 CCTGGATTTATGGAACCAAGA pLKO.1 2108 CDS 100% 4.050 2.835 N SLC6A17 n/a
8 TRCN0000038514 CGGAAACTACTTTGTCACCAT pLKO.1 2022 CDS 100% 2.640 1.848 N SLC6A17 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4119 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.