Transcript: Mouse XM_006501431.3

PREDICTED: Mus musculus kynurenine aminotransferase 3 (Kyat3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kyat3 (229905)
Length:
1817
CDS:
161..1423

Additional Resources:

NCBI RefSeq record:
XM_006501431.3
NBCI Gene record:
Kyat3 (229905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120413 GCCAAAGGAATTAGAAGTAAA pLKO.1 1084 CDS 100% 13.200 18.480 N Kyat3 n/a
2 TRCN0000320076 GCCAAAGGAATTAGAAGTAAA pLKO_005 1084 CDS 100% 13.200 18.480 N Kyat3 n/a
3 TRCN0000120412 CCTAACCATGTTCGGTACATT pLKO.1 1548 3UTR 100% 5.625 7.875 N Kyat3 n/a
4 TRCN0000350146 CCTAACCATGTTCGGTACATT pLKO_005 1548 3UTR 100% 5.625 7.875 N Kyat3 n/a
5 TRCN0000120414 CGTCAAATTGATCCAAACGAA pLKO.1 416 CDS 100% 3.000 4.200 N Kyat3 n/a
6 TRCN0000319999 CGTCAAATTGATCCAAACGAA pLKO_005 416 CDS 100% 3.000 4.200 N Kyat3 n/a
7 TRCN0000120415 GAGCCTTATGACTATAAGTTT pLKO.1 1229 CDS 100% 0.563 0.788 N Kyat3 n/a
8 TRCN0000320077 GAGCCTTATGACTATAAGTTT pLKO_005 1229 CDS 100% 0.563 0.788 N Kyat3 n/a
9 TRCN0000151215 GATGAGGTTTATGAATGGCTT pLKO.1 794 CDS 100% 2.640 2.112 N KYAT3 n/a
10 TRCN0000120416 GTGAAGTGGATGACGAAACAT pLKO.1 1250 CDS 100% 5.625 3.938 N Kyat3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12300 pDONR223 100% 58.8% 59.2% None (many diffs) n/a
2 ccsbBroad304_12300 pLX_304 0% 58.8% 59.2% V5 (many diffs) n/a
3 TRCN0000467583 TTTAGCTTGTCCCACATATTATTA pLX_317 44% 58.8% 59.2% V5 (many diffs) n/a
Download CSV