Transcript: Mouse XM_006501441.3

PREDICTED: Mus musculus adenylate kinase 5 (Ak5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ak5 (229949)
Length:
1817
CDS:
522..1598

Additional Resources:

NCBI RefSeq record:
XM_006501441.3
NBCI Gene record:
Ak5 (229949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488605 TATCTCCTCTGCAGGTCTTGTGGC pLX_317 18.9% 54.8% 59.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491369 GCCTTTCTAGTGGCGGGGCCTAGA pLX_317 18.8% 54.8% 59.3% V5 (many diffs) n/a
Download CSV