Transcript: Mouse XM_006501533.3

PREDICTED: Mus musculus phospholipase C, eta 1 (Plch1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plch1 (269437)
Length:
6818
CDS:
500..5584

Additional Resources:

NCBI RefSeq record:
XM_006501533.3
NBCI Gene record:
Plch1 (269437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419491 GCCCTGCCTGTGACGTATTTA pLKO_005 1386 CDS 100% 15.000 21.000 N Plch1 n/a
2 TRCN0000419148 CATGCATTTGTATATAGATTC pLKO_005 5727 3UTR 100% 10.800 15.120 N Plch1 n/a
3 TRCN0000097100 GCAGCGAAGATAAACCCGAAA pLKO.1 5541 CDS 100% 4.050 5.670 N Plch1 n/a
4 TRCN0000097103 CGCATTATGTTCGGAAGCGAT pLKO.1 3252 CDS 100% 2.640 3.696 N Plch1 n/a
5 TRCN0000097102 GCGTTACTCAAGGCTACACAT pLKO.1 2084 CDS 100% 4.950 3.960 N Plch1 n/a
6 TRCN0000428296 ACTCTAGAAGATGTTAGATTT pLKO_005 5620 3UTR 100% 13.200 9.240 N Plch1 n/a
7 TRCN0000433540 GATGCTTCTCCTGGTCAATTT pLKO_005 4439 CDS 100% 13.200 9.240 N Plch1 n/a
8 TRCN0000425627 GTGGTTACATTGCCCTTTATG pLKO_005 6069 3UTR 100% 13.200 9.240 N Plch1 n/a
9 TRCN0000436392 TAACCATCAATGAGATCTTTG pLKO_005 3096 CDS 100% 10.800 7.560 N Plch1 n/a
10 TRCN0000097101 CGTGACTTTAACAAATGAGAA pLKO.1 4075 CDS 100% 4.950 3.465 N Plch1 n/a
11 TRCN0000097099 CCGACTTTAATCCCAGTAGAA pLKO.1 6373 3UTR 100% 4.950 2.970 N Plch1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501533.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.