Transcript: Mouse XM_006501606.3

PREDICTED: Mus musculus DENN/MADD domain containing 2C (Dennd2c), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dennd2c (329727)
Length:
3726
CDS:
354..1790

Additional Resources:

NCBI RefSeq record:
XM_006501606.3
NBCI Gene record:
Dennd2c (329727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178463 GCCAAACACTTGACTTATGAA pLKO.1 2803 3UTR 100% 5.625 3.938 N Dennd2c n/a
2 TRCN0000182316 GCCAGTGTCCATGATTGACAT pLKO.1 1187 CDS 100% 4.950 3.465 N Dennd2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13334 pDONR223 100% 34.6% 35.5% None (many diffs) n/a
2 ccsbBroad304_13334 pLX_304 0% 34.6% 35.5% V5 (many diffs) n/a
3 TRCN0000472271 GCTTAGCCCCTCTCTGAAATGCAC pLX_317 15.9% 34.6% 35.5% V5 (many diffs) n/a
Download CSV