Transcript: Mouse XM_006502052.3

PREDICTED: Mus musculus tryptophanyl tRNA synthetase 2 (mitochondrial) (Wars2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wars2 (70560)
Length:
5629
CDS:
413..1306

Additional Resources:

NCBI RefSeq record:
XM_006502052.3
NBCI Gene record:
Wars2 (70560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437635 CAGGATCTAGCTCGAAGTTTC pLKO_005 791 CDS 100% 10.800 15.120 N Wars2 n/a
2 TRCN0000447319 ACTCGCCACTGTTCGAATAAC pLKO_005 925 CDS 100% 13.200 10.560 N Wars2 n/a
3 TRCN0000413144 TTCATAAAGAGAGGTTCATTC pLKO_005 1632 3UTR 100% 10.800 8.640 N Wars2 n/a
4 TRCN0000076304 GCCGATGCTGTGATTGAGAAA pLKO.1 1142 CDS 100% 4.950 3.465 N Wars2 n/a
5 TRCN0000076305 GCAGCATTTACACCAGTGGAA pLKO.1 631 CDS 100% 2.640 1.848 N Wars2 n/a
6 TRCN0000076303 GCTCTGTGAAATCACAGAGTA pLKO.1 2543 3UTR 100% 0.495 0.347 N Wars2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2778 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07590 pDONR223 100% 61.3% 61.3% None (many diffs) n/a
2 ccsbBroad304_07590 pLX_304 0% 61.3% 61.3% V5 (many diffs) n/a
3 TRCN0000466879 CTTATAACGTTATGAAACTCGTCA pLX_317 39.3% 61.3% 61.3% V5 (many diffs) n/a
Download CSV