Construct: ORF TRCN0000466879
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000821.1_s317c1
- Derived from:
- ccsbBroadEn_07590
- DNA Barcode:
- CTTATAACGTTATGAAACTCGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WARS2 (10352)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466879
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | NM_015836.3 | 99.9% | 99.7% | 148G>A |
| 2 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_005270350.3 | 93.8% | 91.6% | (many diffs) |
| 3 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_011540494.2 | 92.5% | 91.3% | (many diffs) |
| 4 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_017000039.1 | 92.5% | 91.3% | (many diffs) |
| 5 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_024449826.1 | 92.5% | 91.3% | (many diffs) |
| 6 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_017000038.1 | 89.5% | 81.7% | 148G>A;429_430ins86;549_577del |
| 7 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_017000040.1 | 84% | 83.8% | 148G>A;176_177ins171 |
| 8 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_011540495.2 | 76.1% | 76.1% | 87_88ins258 |
| 9 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_024449860.1 | 73.8% | 73.8% | 0_1ins282 |
| 10 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_024449871.1 | 73.8% | 73.8% | 0_1ins282 |
| 11 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_017000041.2 | 64.2% | 56.7% | 0_1ins282;147_148ins86;267_295del |
| 12 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | NM_201263.2 | 58.8% | 59.1% | (many diffs) |
| 13 | human | 10352 | WARS2 | tryptophanyl tRNA synthetas... | XM_017000042.1 | 53.2% | 40.1% | 148G>A;429_430ins86;576_577ins418 |
| 14 | mouse | 70560 | Wars2 | tryptophanyl tRNA synthetas... | NM_027462.4 | 85.4% | 86.1% | (many diffs) |
| 15 | mouse | 70560 | Wars2 | tryptophanyl tRNA synthetas... | XM_006502052.3 | 61.3% | 61.3% | (many diffs) |
| 16 | mouse | 70560 | Wars2 | tryptophanyl tRNA synthetas... | XM_011240223.2 | 54.7% | 55.8% | (many diffs) |
| 17 | mouse | 70560 | Wars2 | tryptophanyl tRNA synthetas... | XM_006502053.3 | 43% | 39.9% | (many diffs) |
| 18 | mouse | 70560 | Wars2 | tryptophanyl tRNA synthetas... | XR_001783742.1 | 15.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1146
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gctgcactca atgcggaaag cgcgtgagcg ctggagcttc atccgggcac 121 ttcataaggg atccgcagct gctcccgctc tccagaaaga cagcaagaag cgagtatttt 181 ccggcattca acctacagga atcctccacc tgagcaatta cctgggagcc attgagagct 241 gggtgaggtt acaggatgaa tatgactctg tattatacag cattgttgac ctccactcca 301 ttactgtccc ccaagaccca gctgtccttc ggcagagcat cctggacatg actgctgttc 361 ttcttgcctg tggcataaac ccggaaaaaa gcatcctttt ccaacaatct caggtgtctg 421 aacacacaca attaagttgg atcctttcct gcatggtcag actacctcga ttacaacatt 481 tacatcagtg gaaggcaaag actaccaagc agaagcacga tggcacggtg ggcctgctca 541 catacccagt actccaggca gccgacattc tgttgtacaa gtccacacac gttcctgttg 601 gggaggatca agtccagcac atggaactag ttcaggatct agcacaaggt ttcaacaaga 661 agtatgggga gttctttcca gtgcccgagt ccattctcac atccatgaag aaggtaaaat 721 cccTACGTGA TCCTTCTGCC AAAATGTCGA AATCAGACCC TGACAAACTG GCCACCGTCC 781 GAATAACAGA CAGCCCAGAG GAGATAGTGC AGAAATTCCG CAAGGCTGTG ACAGACTTCA 841 CCTCGGAGGT CACCTATGAC CCGGCTGGCC GCGCTGGCGT GTCCAACATA GTGGCGGTGC 901 ATGCCGCGGT GACGGGGCTC TCCGTGGAGG AAGTGGTGCG CCGCAGCGCG GGCATGAACA 961 CTGCTCGCTA CAAGCTGGCC GTGGCAGATG CTGTGATTGA GAAGTTTGCC CCAATTAAGC 1021 GTGAAATTGA AAAACTGAAG CTGGACAAGG ACCATTTAGA GAAGGTTTTA CAAATTGGAT 1081 CAGCAAAAGC CAAAGAATTA GCATACACTG TGTGCCAGGA GGTGAAGAAA TTGGTGGGTT 1141 TTCTATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1201 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1261 CTTGGCTTTA TATATCTTGT GGAAAGGACG ACTTATAACG TTATGAAACT CGTCAACGCG 1321 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt