Transcript: Mouse XM_006502088.3

PREDICTED: Mus musculus tubulin tyrosine ligase-like family, member 7 (Ttll7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttll7 (70892)
Length:
7319
CDS:
398..3061

Additional Resources:

NCBI RefSeq record:
XM_006502088.3
NBCI Gene record:
Ttll7 (70892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341293 AGTCTCGGCCTATGGATTATA pLKO_005 753 CDS 100% 15.000 12.000 N Ttll7 n/a
2 TRCN0000341294 TTGCCATGGGCTCGCTTAATA pLKO_005 3070 3UTR 100% 15.000 12.000 N Ttll7 n/a
3 TRCN0000341296 CTAAGTTCTGGAGTGATATTT pLKO_005 1263 CDS 100% 15.000 10.500 N Ttll7 n/a
4 TRCN0000341292 ACTAGACCAAGTCCCATATAG pLKO_005 2125 CDS 100% 13.200 9.240 N Ttll7 n/a
5 TRCN0000341356 CTACCAGGAAGTACCCAATTT pLKO_005 2948 CDS 100% 13.200 9.240 N Ttll7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12610 pDONR223 100% 53.7% 56% None (many diffs) n/a
2 ccsbBroad304_12610 pLX_304 0% 53.7% 56% V5 (many diffs) n/a
3 TRCN0000466520 ATACGCACAAGGAAGCCATGCTGT pLX_317 22.5% 53.7% 56% V5 (many diffs) n/a
Download CSV