Construct: ORF TRCN0000466520
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013168.1_s317c1
- Derived from:
- ccsbBroadEn_12610
- DNA Barcode:
- ATACGCACAAGGAAGCCATGCTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTLL7 (79739)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466520
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XM_011542159.3 | 98% | 97.2% | (many diffs) |
2 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_001737415.2 | 76.7% | (many diffs) | |
3 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | NM_001350214.2 | 60.9% | 59.3% | (many diffs) |
4 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | NM_024686.6 | 60.9% | 59.3% | (many diffs) |
5 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | NM_001350215.2 | 57.9% | 56.2% | (many diffs) |
6 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XM_017002349.2 | 33.3% | 31.9% | (many diffs) |
7 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XM_024449807.1 | 33.3% | 31.9% | (many diffs) |
8 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_001737411.2 | 20.4% | (many diffs) | |
9 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_946760.3 | 20.3% | (many diffs) | |
10 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_001737413.2 | 20.3% | (many diffs) | |
11 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_001737409.2 | 20.2% | (many diffs) | |
12 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_946758.3 | 20.2% | (many diffs) | |
13 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_001737412.2 | 20.2% | (many diffs) | |
14 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_001737410.2 | 20.1% | 1_292del;774C>G;1922_8065del | |
15 | human | 79739 | TTLL7 | tubulin tyrosine ligase like 7 | XR_001737414.2 | 20.1% | (many diffs) | |
16 | mouse | 70892 | Ttll7 | tubulin tyrosine ligase-lik... | NM_001302958.1 | 78.2% | 81.6% | (many diffs) |
17 | mouse | 70892 | Ttll7 | tubulin tyrosine ligase-lik... | XM_017319722.1 | 54% | 56.3% | (many diffs) |
18 | mouse | 70892 | Ttll7 | tubulin tyrosine ligase-lik... | XM_006502088.3 | 53.7% | 56% | (many diffs) |
19 | mouse | 70892 | Ttll7 | tubulin tyrosine ligase-lik... | XM_017319721.1 | 52.5% | 54.7% | (many diffs) |
20 | mouse | 70892 | Ttll7 | tubulin tyrosine ligase-lik... | NM_001302957.1 | 52.3% | 54.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1695
- ORF length:
- 1629
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc atctctgcct caagaaggag ttattcaggg accctctccc ctggatttga 121 atacagaatt accttatcaa agcacaatga aaaggaaagt cagaaagaag aaaaagaagg 181 gaaccattac agcaaatgtt gccgggacaa agtttgaaat tgttcgttta gtaatagatg 241 aaatgggatt tatgaaaact ccagatgagg atgaaacaag taatcttata tggtgtgatt 301 ctgctgttca gcaggagaaa atttcagagc tgcaaaatta tcagaggatc aaccattttc 361 caggaatggg ggagatctgt aggaaggatt tcttagcaag aaatatgacc aaaatgatca 421 agtctcggcc tctggattat acctttgttc ctcgaacttg gatctttcct gctgaatata 481 ctcaattcca aaattatgtg aaagaattga agaaaaaacg gaagcagaaa acttttatag 541 tgaaacgagc taatggtgca atgggtcatg ggatttcttt gataagaaat ggtgacaaac 601 ttccatctca ggatcatttg attgttcaag aatacattga aaagcctttc ctaatggaag 661 gttacaagtt tgacttacga atttatattc tggttacatc gtgtgatcca ctaaaaatat 721 ttctctacca tgatgggctt gtgcgaatgg gtacagagaa gtacattcca cctaatgagt 781 ccaatttgac ccagttatac atgcatctga caaactactc cgtgaacaag cataatgagc 841 attttgaacg ggatgaaact gagaacaaag gcagcaaacg ttccatcaaa tggtttacag 901 aattccttca agcaaatcaa catgatgttg ctaagttttg gagtgatatt tcagaattgg 961 tggtaaagac cctgattgta gcagaacctc atgtcctgca tgcctatcga atgtgtagac 1021 ctggtcaacc tccaggaagc gaaagtgtct gctttgaagt cctgggattt gatattttgt 1081 tggatagaaa actaaagcca tggcttctgg agattaaccg agccccaagc tttggaactg 1141 atcagaaaat agactatgat gtaaaaaggg gagtgctgct aaatgcgttg aagctactaa 1201 acataaggac cagtgacaaa agaagaaact tggccaaaca aaaagctgag gctcaaagga 1261 ggctctatgg tcaaaattca attaaaaggc tcttaccagg ctcctcagac tgggaacagc 1321 agagacacca gttGGAGAGG CGGAAAGAAG AGTTGAAAGA GAGACTCGCT CAAGTACGAA 1381 AGCAGATCTC ACGAGAAGAA CATGAAAATC GACATATGGG GAATTATAGA CGAATTTATC 1441 CTCCTGAAGA TAAAGCATTA CTTGAAAAGT ATGAAAATTT GTTAGCTGTT GCCTTTCAGA 1501 CCTTCCTTTC AGGAAGAGCA GCTTCATTCC AGCGAGAGTT GAATAATCCT TTGAAAAGGA 1561 TGAAGGAAGA AGATATTTTG GATCTTCTGG AGCAATGTGA AATTGATGAT GAAAAGTTGA 1621 TGGGAAAAAC TACCAAGACT CGAGGACCAA AGGGTCGAAT AACTCATTAT GTAGTCAAGC 1681 TCTTTAAGAA CACTTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1741 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1801 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA ATACGCACAA GGAAGCCATG 1861 CTGTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt