Transcript: Mouse XM_006502145.1

PREDICTED: Mus musculus golgi integral membrane protein 4 (Golim4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Golim4 (73124)
Length:
3693
CDS:
63..2045

Additional Resources:

NCBI RefSeq record:
XM_006502145.1
NBCI Gene record:
Golim4 (73124)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144373 CAGACTCAAGTTGCAGAATAT pLKO.1 744 CDS 100% 13.200 18.480 N GOLIM4 n/a
2 TRCN0000126037 CGGGAAATGGAGCATAATGTT pLKO.1 1857 CDS 100% 5.625 7.875 N Golim4 n/a
3 TRCN0000325751 CGGGAAATGGAGCATAATGTT pLKO_005 1857 CDS 100% 5.625 7.875 N Golim4 n/a
4 TRCN0000126035 CCCAACAATCAAGGCGAAGAT pLKO.1 1695 CDS 100% 4.950 6.930 N Golim4 n/a
5 TRCN0000325719 CCCAACAATCAAGGCGAAGAT pLKO_005 1695 CDS 100% 4.950 6.930 N Golim4 n/a
6 TRCN0000126034 CCCTGAAATGAGCACATATTT pLKO.1 3153 3UTR 100% 15.000 12.000 N Golim4 n/a
7 TRCN0000325720 CCCTGAAATGAGCACATATTT pLKO_005 3153 3UTR 100% 15.000 12.000 N Golim4 n/a
8 TRCN0000126038 GCCCAGTTGCAAGTTGTATAT pLKO.1 237 CDS 100% 13.200 10.560 N Golim4 n/a
9 TRCN0000325673 GCCCAGTTGCAAGTTGTATAT pLKO_005 237 CDS 100% 13.200 10.560 N Golim4 n/a
10 TRCN0000423265 ACAGATCAAGATTAGAGAAAT pLKO_005 262 CDS 100% 13.200 7.920 N GOLIM4 n/a
11 TRCN0000126036 GCAAGATTCCAATAGCAGATA pLKO.1 374 CDS 100% 4.950 2.970 N Golim4 n/a
12 TRCN0000325674 GCAAGATTCCAATAGCAGATA pLKO_005 374 CDS 100% 4.950 2.970 N Golim4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.