Transcript: Mouse XM_006502169.2

PREDICTED: Mus musculus ubiquitin-associated protein 2-like (Ubap2l), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubap2l (74383)
Length:
4010
CDS:
147..3518

Additional Resources:

NCBI RefSeq record:
XM_006502169.2
NBCI Gene record:
Ubap2l (74383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217173 CAGATGATTTCGGACCATAAT pLKO.1 264 CDS 100% 13.200 18.480 N Ubap2l n/a
2 TRCN0000241398 CAGATGATTTCGGACCATAAT pLKO_005 264 CDS 100% 13.200 18.480 N Ubap2l n/a
3 TRCN0000272739 CAGATGATTTCGGACCATAAT pLKO_005 264 CDS 100% 13.200 18.480 N UBAP2L n/a
4 TRCN0000007679 CCGCCACAAGTATATGGTTAT pLKO.1 2694 CDS 100% 10.800 15.120 N UBAP2L n/a
5 TRCN0000241396 ACACGGGCGTGCCAGATATAT pLKO_005 3178 CDS 100% 15.000 12.000 N Ubap2l n/a
6 TRCN0000241400 ATTGTTGCCTAATCCATATAT pLKO_005 2645 CDS 100% 15.000 10.500 N Ubap2l n/a
7 TRCN0000217827 CAGATATCTCAGGGCTAAATC pLKO.1 1780 CDS 100% 13.200 9.240 N Ubap2l n/a
8 TRCN0000241397 CAGATATCTCAGGGCTAAATC pLKO_005 1780 CDS 100% 13.200 9.240 N Ubap2l n/a
9 TRCN0000007677 CCCACCCTGTTGTATGTATTA pLKO.1 3685 3UTR 100% 13.200 9.240 N UBAP2L n/a
10 TRCN0000241399 GCCTATCCGCCACAAGTATAT pLKO_005 2688 CDS 100% 13.200 9.240 N Ubap2l n/a
11 TRCN0000191423 CAGTGAAATCTGAATCACCTT pLKO.1 2179 CDS 100% 2.640 1.848 N Ubap2l n/a
12 TRCN0000201552 CCACACAACATAGCAGTGCAT pLKO.1 2323 CDS 100% 2.640 1.848 N Ubap2l n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3933 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07506 pDONR223 100% 91.3% 94.8% None (many diffs) n/a
2 ccsbBroad304_07506 pLX_304 0% 91.3% 94.8% V5 (many diffs) n/a
3 TRCN0000472263 TTGACGGGTTGTACTTTACCACAA pLX_317 11.8% 91.3% 94.8% V5 (many diffs) n/a
Download CSV