Transcript: Mouse XM_006502201.3

PREDICTED: Mus musculus solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1 (Slc9b1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc9b1 (74446)
Length:
2262
CDS:
546..2243

Additional Resources:

NCBI RefSeq record:
XM_006502201.3
NBCI Gene record:
Slc9b1 (74446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502201.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305923 ACTCTACTCTGGGCCCTTATA pLKO_005 933 CDS 100% 13.200 18.480 N Slc9b1 n/a
2 TRCN0000305988 TGGCACTATCTGTTCGAATTT pLKO_005 1918 CDS 100% 13.200 18.480 N Slc9b1 n/a
3 TRCN0000127080 GCCCTTACTATTATCCTAGTA pLKO.1 1176 CDS 100% 0.495 0.693 N Slc9b1 n/a
4 TRCN0000325443 GCCCTTACTATTATCCTAGTA pLKO_005 1176 CDS 100% 0.495 0.693 N Slc9b1 n/a
5 TRCN0000127081 CCATCAGGAATGTTCCGATTA pLKO.1 1102 CDS 100% 10.800 8.640 N Slc9b1 n/a
6 TRCN0000325445 CCATCAGGAATGTTCCGATTA pLKO_005 1102 CDS 100% 10.800 8.640 N Slc9b1 n/a
7 TRCN0000127082 CCACCTCTCATTGGGATGTTA pLKO.1 1068 CDS 100% 5.625 3.938 N Slc9b1 n/a
8 TRCN0000127083 GTAACTGTTGAGATGTCCAAA pLKO.1 600 CDS 100% 4.950 3.465 N Slc9b1 n/a
9 TRCN0000325379 GTAACTGTTGAGATGTCCAAA pLKO_005 600 CDS 100% 4.950 3.465 N Slc9b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502201.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.