Transcript: Mouse XM_006502256.3

PREDICTED: Mus musculus G-protein signalling modulator 2 (AGS3-like, C. elegans) (Gpsm2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpsm2 (76123)
Length:
2767
CDS:
296..2278

Additional Resources:

NCBI RefSeq record:
XM_006502256.3
NBCI Gene record:
Gpsm2 (76123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502256.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222305 GCGCTCTACAATCTTGGAAAT pLKO.1 668 CDS 100% 10.800 15.120 N Gpsm2 n/a
2 TRCN0000292821 GCGCTCTACAATCTTGGAAAT pLKO_005 668 CDS 100% 10.800 15.120 N Gpsm2 n/a
3 TRCN0000222307 GCGTTAGAATACCACCACCAT pLKO.1 479 CDS 100% 2.640 3.696 N Gpsm2 n/a
4 TRCN0000292889 GCGTTAGAATACCACCACCAT pLKO_005 479 CDS 100% 2.640 3.696 N Gpsm2 n/a
5 TRCN0000028892 GCCGAATTGGAACAGTGAAAT pLKO.1 1504 CDS 100% 13.200 9.240 N Gpsm2 n/a
6 TRCN0000292891 GCCGAATTGGAACAGTGAAAT pLKO_005 1504 CDS 100% 13.200 9.240 N Gpsm2 n/a
7 TRCN0000222306 GCATACATATTCCTGGGTGAA pLKO.1 989 CDS 100% 4.050 2.835 N Gpsm2 n/a
8 TRCN0000292890 GCATACATATTCCTGGGTGAA pLKO_005 989 CDS 100% 4.050 2.835 N Gpsm2 n/a
9 TRCN0000222308 CTGATGACAAATGACAAGAAA pLKO.1 1991 CDS 100% 5.625 3.375 N Gpsm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502256.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.