Transcript: Mouse XM_006502287.1

PREDICTED: Mus musculus amylo-1,6-glucosidase, 4-alpha-glucanotransferase (Agl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agl (77559)
Length:
7453
CDS:
543..5141

Additional Resources:

NCBI RefSeq record:
XM_006502287.1
NBCI Gene record:
Agl (77559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252247 ACGTGAGTGGTCGGCTTATTT pLKO_005 3448 CDS 100% 15.000 21.000 N Agl n/a
2 TRCN0000252244 GACAACGCAGATCCTATATTA pLKO_005 3186 CDS 100% 15.000 21.000 N Agl n/a
3 TRCN0000252245 TTCCGATTAGGCCCAACTTTA pLKO_005 639 CDS 100% 13.200 10.560 N Agl n/a
4 TRCN0000252246 CTGCTACTTTGACGCTATATT pLKO_005 3554 CDS 100% 15.000 10.500 N Agl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00038 pDONR223 100% 86.1% 91.9% None (many diffs) n/a
2 ccsbBroad304_00038 pLX_304 0% 86.1% 91.9% V5 (many diffs) n/a
3 TRCN0000475911 AGGACCATAGCAGTTATTCAGTTT pLX_317 6.3% 86.1% 91.9% V5 (many diffs) n/a
Download CSV