Transcript: Mouse XM_006502658.2

PREDICTED: Mus musculus rearranged L-myc fusion sequence (Rlf), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rlf (109263)
Length:
5897
CDS:
317..5425

Additional Resources:

NCBI RefSeq record:
XM_006502658.2
NBCI Gene record:
Rlf (109263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252714 GTACACTACAGCATCTTATAT pLKO_005 5837 3UTR 100% 15.000 12.000 N Rlf n/a
2 TRCN0000226215 ACGAGAACATCAAGGTTATTC pLKO_005 2758 CDS 100% 13.200 10.560 N Rlf n/a
3 TRCN0000252717 CAGATGAATAGTGCCTATTTA pLKO_005 4412 CDS 100% 15.000 10.500 N Rlf n/a
4 TRCN0000252716 ACAGCTCTTCCACGTCAATAA pLKO_005 2358 CDS 100% 13.200 9.240 N Rlf n/a
5 TRCN0000217994 ACATCTGCCAAAGGTCATTTA pLKO_005 3177 CDS 100% 13.200 9.240 N Rlf n/a
6 TRCN0000252715 CTTCCATTTCAGACGTTAATC pLKO_005 2952 CDS 100% 13.200 9.240 N Rlf n/a
7 TRCN0000218850 GCAATTCTAGTGATCAGTTAA pLKO_005 2334 CDS 100% 13.200 9.240 N Rlf n/a
8 TRCN0000252713 GGGTCAGCTAGTGCTCATATA pLKO_005 2279 CDS 100% 13.200 9.240 N Rlf n/a
9 TRCN0000226217 ACTCTTGTTTGGTGCTAATTA pLKO_005 5660 3UTR 100% 15.000 9.000 N Rlf n/a
10 TRCN0000226216 TACCGACATAAGGACTATTAT pLKO_005 4046 CDS 100% 0.000 0.000 N Rlf n/a
11 TRCN0000014988 GCATGATTGTATATGGAACAA pLKO.1 5723 3UTR 100% 4.950 3.465 N RLF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502658.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468871 GCGGGCTTCACACATAGGTTTACT pLX_317 7.8% 76.2% 77.4% V5 (many diffs) n/a
Download CSV