Transcript: Mouse XM_006502796.3

PREDICTED: Mus musculus ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (Elavl4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elavl4 (15572)
Length:
3203
CDS:
16..1179

Additional Resources:

NCBI RefSeq record:
XM_006502796.3
NBCI Gene record:
Elavl4 (15572)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112098 GTGTTGCAAGTTTCCTTTAAA pLKO.1 1135 CDS 100% 15.000 21.000 N Elavl4 n/a
2 TRCN0000112097 CTGGTGCATCTTCGTCTATAA pLKO.1 924 CDS 100% 13.200 9.240 N Elavl4 n/a
3 TRCN0000429224 TTACCCAGCCAGCTAACTTTA pLKO_005 1483 3UTR 100% 13.200 9.240 N ELAVL4 n/a
4 TRCN0000112095 GCGGTGCTACAGAACCGATTA pLKO.1 632 CDS 100% 10.800 7.560 N Elavl4 n/a
5 TRCN0000038708 GTTTAGGGTATGGATTTGTTA pLKO.1 293 CDS 100% 5.625 3.938 N ELAVL4 n/a
6 TRCN0000038706 CCGACATCCAATACAAGCAAT pLKO.1 82 CDS 100% 4.950 3.465 N ELAVL4 n/a
7 TRCN0000112099 CCGCTTTGATAAGAGGATTGA pLKO.1 570 CDS 100% 4.950 3.465 N Elavl4 n/a
8 TRCN0000112096 CCAACCTCATCGTCAACTATT pLKO.1 173 CDS 100% 13.200 6.600 Y Elavl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06154 pDONR223 100% 88.6% 93% None (many diffs) n/a
2 ccsbBroad304_06154 pLX_304 0% 88.6% 93% V5 (many diffs) n/a
3 TRCN0000470496 AAACATACCGACTTGACATAGCAG pLX_317 45.3% 88.6% 93% V5 (many diffs) n/a
Download CSV