Transcript: Mouse XM_006502899.3

PREDICTED: Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (St3gal3), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St3gal3 (20441)
Length:
1197
CDS:
116..1069

Additional Resources:

NCBI RefSeq record:
XM_006502899.3
NBCI Gene record:
St3gal3 (20441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018836 CGGATTGACGACTATGACATT pLKO.1 707 CDS 100% 4.950 6.930 N St3gal3 n/a
2 TRCN0000277418 ATGCAGCGACCTGAGCAATAT pLKO_005 818 CDS 100% 13.200 10.560 N St3gal3 n/a
3 TRCN0000018833 CGCTGCATCATTGTAGGCAAT pLKO.1 653 CDS 100% 4.050 3.240 N St3gal3 n/a
4 TRCN0000277416 CTCCTGAAGCTGGACTCTAAA pLKO_005 365 CDS 100% 13.200 9.240 N St3gal3 n/a
5 TRCN0000035716 GCCATCTTGTCAGTCACCAAA pLKO.1 590 CDS 100% 4.950 3.465 N ST3GAL3 n/a
6 TRCN0000018834 GCTGAAGTACATCGTCTACAA pLKO.1 892 CDS 100% 4.950 3.465 N St3gal3 n/a
7 TRCN0000277417 GCTGAAGTACATCGTCTACAA pLKO_005 892 CDS 100% 4.950 3.465 N St3gal3 n/a
8 TRCN0000018832 GCCACCAAGTACGCAAACTTT pLKO.1 401 CDS 100% 5.625 3.375 N St3gal3 n/a
9 TRCN0000277466 GCCACCAAGTACGCAAACTTT pLKO_005 401 CDS 100% 5.625 3.375 N St3gal3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01534 pDONR223 100% 61.9% 60.2% None (many diffs) n/a
2 ccsbBroad304_01534 pLX_304 0% 61.9% 60.2% V5 (many diffs) n/a
3 TRCN0000492269 CGTGAGCGCATCGCAAAACCGGGC pLX_317 35.8% 61.9% 60.2% V5 (many diffs) n/a
Download CSV