Transcript: Mouse XM_006502983.4

PREDICTED: Mus musculus terminal uridylyl transferase 4 (Tut4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tut4 (230594)
Length:
4117
CDS:
286..3411

Additional Resources:

NCBI RefSeq record:
XM_006502983.4
NBCI Gene record:
Tut4 (230594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502983.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241805 CAGAGCAGCTTATCGATATTT pLKO_005 2445 CDS 100% 15.000 10.500 N Tut4 n/a
2 TRCN0000241802 GACAAACCGATTTCGAGAAAT pLKO_005 3165 CDS 100% 13.200 9.240 N Tut4 n/a
3 TRCN0000241803 GGGCTAAGCTGTGCTATATTG pLKO_005 1853 CDS 100% 13.200 9.240 N Tut4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502983.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07867 pDONR223 100% 54.2% 51.7% None (many diffs) n/a
2 ccsbBroad304_07867 pLX_304 0% 54.2% 51.7% V5 (many diffs) n/a
3 TRCN0000469078 ATAGACGTCGAATAATTACGACAT pLX_317 6.3% 54.2% 51.7% V5 (many diffs) n/a
Download CSV