Transcript: Mouse XM_006503090.2

PREDICTED: Mus musculus solute carrier family 1 (glutamate transporter), member 7 (Slc1a7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc1a7 (242607)
Length:
2478
CDS:
158..1402

Additional Resources:

NCBI RefSeq record:
XM_006503090.2
NBCI Gene record:
Slc1a7 (242607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079851 CGCTTCCGAACCATGATTAAT pLKO.1 1085 CDS 100% 15.000 21.000 N Slc1a7 n/a
2 TRCN0000079849 GCTAGACTTTGGACAGATCAT pLKO.1 916 CDS 100% 4.950 6.930 N Slc1a7 n/a
3 TRCN0000416436 GCTCACGTGTGCAGAACTTTG pLKO_005 294 CDS 100% 10.800 7.560 N Slc1a7 n/a
4 TRCN0000437604 TGGTAGAAGCCACGTTCAAAC pLKO_005 174 CDS 100% 10.800 7.560 N Slc1a7 n/a
5 TRCN0000079848 CCACAGCATGTGTGTTGGTTT pLKO.1 1923 3UTR 100% 4.950 3.465 N Slc1a7 n/a
6 TRCN0000079850 GTGCCTTAATGAGTCTGTCAT pLKO.1 472 CDS 100% 4.950 3.465 N Slc1a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06958 pDONR223 100% 64.8% 68.9% None (many diffs) n/a
2 ccsbBroad304_06958 pLX_304 0% 64.8% 68.9% V5 (many diffs) n/a
3 TRCN0000472841 CTACTTATCCTGAACTACCACGTC pLX_317 29.8% 64.8% 68.9% V5 (many diffs) n/a
Download CSV