Transcript: Mouse XM_006503299.3

PREDICTED: Mus musculus OMA1 zinc metallopeptidase (Oma1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Oma1 (67013)
Length:
9102
CDS:
1853..3418

Additional Resources:

NCBI RefSeq record:
XM_006503299.3
NBCI Gene record:
Oma1 (67013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374954 CCAAGCTGTCCTGCCGTAATA pLKO_005 2213 CDS 100% 13.200 18.480 N Oma1 n/a
2 TRCN0000031083 GTGCCGATGTAAGAGCTAGTT pLKO.1 3060 CDS 100% 4.950 6.930 N Oma1 n/a
3 TRCN0000335429 GTGCCGATGTAAGAGCTAGTT pLKO_005 3060 CDS 100% 4.950 6.930 N Oma1 n/a
4 TRCN0000375013 CCAAATGGACAAGTGTTTATT pLKO_005 2741 CDS 100% 15.000 12.000 N Oma1 n/a
5 TRCN0000031080 CCCTAACAAGAAGGAGCTATT pLKO.1 2371 CDS 100% 10.800 7.560 N Oma1 n/a
6 TRCN0000335358 CCCTAACAAGAAGGAGCTATT pLKO_005 2371 CDS 100% 10.800 7.560 N Oma1 n/a
7 TRCN0000031082 CGGAAGGAGTAAACTACTGTT pLKO.1 2500 CDS 100% 4.950 3.465 N Oma1 n/a
8 TRCN0000335359 CGGAAGGAGTAAACTACTGTT pLKO_005 2500 CDS 100% 4.950 3.465 N Oma1 n/a
9 TRCN0000031081 GCTTGGTTCATTTACTGGATT pLKO.1 2865 CDS 100% 4.950 2.970 N Oma1 n/a
10 TRCN0000335360 GCTTGGTTCATTTACTGGATT pLKO_005 2865 CDS 100% 4.950 2.970 N Oma1 n/a
11 TRCN0000031079 TGAGCAGCACAGTGGACCTTT pLKO.1 3446 3UTR 100% 4.950 2.970 N Oma1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.