Transcript: Mouse XM_006503409.3

PREDICTED: Mus musculus tetratricopeptide repeat domain 4 (Ttc4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc4 (72354)
Length:
1445
CDS:
210..1430

Additional Resources:

NCBI RefSeq record:
XM_006503409.3
NBCI Gene record:
Ttc4 (72354)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249593 ACCATCTAATGGCGATGTTTA pLKO_005 982 CDS 100% 13.200 18.480 N Ttc4 n/a
2 TRCN0000196065 GCACAGTACTATCTCGGCAAT pLKO.1 450 CDS 100% 4.050 5.670 N Ttc4 n/a
3 TRCN0000217216 CTCGCCTTTCTGTAGGAATTA pLKO.1 1187 CDS 100% 13.200 10.560 N Ttc4 n/a
4 TRCN0000249592 CTCGCCTTTCTGTAGGAATTA pLKO_005 1187 CDS 100% 13.200 10.560 N Ttc4 n/a
5 TRCN0000249591 TATGGAGCCAGGCTAAGTATA pLKO_005 861 CDS 100% 13.200 9.240 N Ttc4 n/a
6 TRCN0000184070 CCTGTGCCATCTTGAACTGAA pLKO.1 548 CDS 100% 4.950 3.465 N Ttc4 n/a
7 TRCN0000249589 AGCAAGCCAAGACCTATAAAG pLKO_005 304 CDS 100% 13.200 7.920 N Ttc4 n/a
8 TRCN0000142847 CCTGATTTGAATGCTGTCCTT pLKO.1 411 CDS 100% 2.640 2.112 N TTC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503409.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07106 pDONR223 100% 65% 63.4% None (many diffs) n/a
2 ccsbBroad304_07106 pLX_304 0% 65% 63.4% V5 (many diffs) n/a
3 TRCN0000473972 GGCACTCGGCTATTACTAGTGACG pLX_317 50.8% 65% 63.4% V5 (many diffs) n/a
Download CSV