Transcript: Mouse XM_006503640.3

PREDICTED: Mus musculus TBC1 domain family, member 14 (Tbc1d14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d14 (100855)
Length:
4846
CDS:
261..2405

Additional Resources:

NCBI RefSeq record:
XM_006503640.3
NBCI Gene record:
Tbc1d14 (100855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193983 GCCGAAATTGTTTGCGCATTT pLKO.1 2018 CDS 100% 10.800 15.120 N Tbc1d14 n/a
2 TRCN0000285662 GCCGAAATTGTTTGCGCATTT pLKO_005 2018 CDS 100% 10.800 15.120 N Tbc1d14 n/a
3 TRCN0000193558 GCAGATATCTACCTAATCGAT pLKO.1 2058 CDS 100% 3.000 4.200 N Tbc1d14 n/a
4 TRCN0000276798 GCAGATATCTACCTAATCGAT pLKO_005 2058 CDS 100% 3.000 4.200 N Tbc1d14 n/a
5 TRCN0000276753 AGGCCAGTCTGGAGCTTATTA pLKO_005 1702 CDS 100% 15.000 10.500 N Tbc1d14 n/a
6 TRCN0000276799 ACGAGCAATTCCAGCGCTATT pLKO_005 870 CDS 100% 10.800 7.560 N Tbc1d14 n/a
7 TRCN0000175891 GCTTGATAGACAGAGAGACTT pLKO.1 1076 CDS 100% 4.950 3.465 N Tbc1d14 n/a
8 TRCN0000176416 CCAGAGATGAAAGGTGTGTTT pLKO.1 2840 3UTR 100% 4.950 2.970 N Tbc1d14 n/a
9 TRCN0000276752 CCAGAGATGAAAGGTGTGTTT pLKO_005 2840 3UTR 100% 4.950 2.970 N Tbc1d14 n/a
10 TRCN0000150169 CATGGCCTTATGTTGACTTAT pLKO.1 1962 CDS 100% 13.200 9.240 N TBC1D14 n/a
11 TRCN0000194519 GATCCCTTTCAGTGCCTGAAT pLKO.1 439 CDS 100% 4.950 3.465 N Tbc1d14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12360 pDONR223 100% 82.4% 86.2% None (many diffs) n/a
2 ccsbBroad304_12360 pLX_304 0% 82.4% 86.2% V5 (many diffs) n/a
3 TRCN0000470728 GGCCTGTACTTCTGCCTAGTCGGA pLX_317 23.8% 82.4% 86.2% V5 (many diffs) n/a
Download CSV