Transcript: Mouse XM_006503685.3

PREDICTED: Mus musculus solute carrier family 2 (facilitated glucose transporter), member 9 (Slc2a9), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc2a9 (117591)
Length:
3753
CDS:
373..1944

Additional Resources:

NCBI RefSeq record:
XM_006503685.3
NBCI Gene record:
Slc2a9 (117591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079398 GCGGGAATAGATGGGATCTTA pLKO.1 3549 3UTR 100% 5.625 4.500 N Slc2a9 n/a
2 TRCN0000079402 GCCACAATATGTATCGCAGGT pLKO.1 1723 CDS 100% 2.160 1.728 N Slc2a9 n/a
3 TRCN0000079399 GTGTGCATCTTGGCCATCATT pLKO.1 1519 CDS 100% 5.625 3.938 N Slc2a9 n/a
4 TRCN0000079400 CGCAGGTGCTACCTACTTCTA pLKO.1 1737 CDS 100% 4.950 3.465 N Slc2a9 n/a
5 TRCN0000079401 GACTGCCATCTTCATCTGCAT pLKO.1 882 CDS 100% 2.640 1.848 N Slc2a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08643 pDONR223 100% 79.1% 82.1% None (many diffs) n/a
2 ccsbBroad304_08643 pLX_304 0% 79.1% 82.1% V5 (many diffs) n/a
Download CSV