Transcript: Mouse XM_006503863.3

PREDICTED: Mus musculus WD repeat domain 1 (Wdr1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr1 (22388)
Length:
1929
CDS:
270..1898

Additional Resources:

NCBI RefSeq record:
XM_006503863.3
NBCI Gene record:
Wdr1 (22388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108911 GCCATGATGGACATATCAATT pLKO.1 1291 CDS 100% 13.200 9.240 N Wdr1 n/a
2 TRCN0000287911 GCCATGATGGACATATCAATT pLKO_005 1291 CDS 100% 13.200 9.240 N Wdr1 n/a
3 TRCN0000295338 CATCCTAAGAAACATCGATAA pLKO_005 389 CDS 100% 10.800 7.560 N Wdr1 n/a
4 TRCN0000108912 GCTGGGAAGATCAAGGACATT pLKO.1 573 CDS 100% 4.950 3.465 N Wdr1 n/a
5 TRCN0000287910 GCTGGGAAGATCAAGGACATT pLKO_005 573 CDS 100% 4.950 3.465 N Wdr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503863.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07517 pDONR223 100% 77.2% 82.5% None (many diffs) n/a
2 ccsbBroad304_07517 pLX_304 0% 77.2% 82.5% V5 (many diffs) n/a
3 TRCN0000467511 GCCGTTCCTTTTTTGCCCACTACG pLX_317 17.5% 77.2% 82.5% V5 (many diffs) n/a
4 ccsbBroadEn_07516 pDONR223 100% 77.2% 82.7% None (many diffs) n/a
5 ccsbBroad304_07516 pLX_304 0% 77.2% 82.7% V5 (many diffs) n/a
6 TRCN0000472452 CATGGAAGTGTCAGTGTGATCTGT pLX_317 26.8% 77.2% 82.7% V5 (many diffs) n/a
Download CSV