Transcript: Mouse XM_006503945.2

PREDICTED: Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 9 (Chrna9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chrna9 (231252)
Length:
1959
CDS:
220..1647

Additional Resources:

NCBI RefSeq record:
XM_006503945.2
NBCI Gene record:
Chrna9 (231252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253093 GTCACGCTCTCCCAGATAAAG pLKO_005 391 CDS 100% 13.200 18.480 N Chrna9 n/a
2 TRCN0000253092 TGTGGTGGATGTCACCTATTT pLKO_005 672 CDS 100% 13.200 9.240 N Chrna9 n/a
3 TRCN0000253091 TTGGTAGGCATTCGATATTTG pLKO_005 1668 3UTR 100% 13.200 9.240 N Chrna9 n/a
4 TRCN0000253094 TCATGACCGTCTTGATCATAG pLKO_005 1613 CDS 100% 10.800 7.560 N Chrna9 n/a
5 TRCN0000253090 TTGGTTCCTGGACCTACAATG pLKO_005 725 CDS 100% 10.800 7.560 N Chrna9 n/a
6 TRCN0000063396 GCCATGACTGTATTTCAGCTA pLKO.1 1039 CDS 100% 2.640 1.848 N CHRNA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503945.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08548 pDONR223 100% 81.9% 87% None (many diffs) n/a
2 ccsbBroad304_08548 pLX_304 0% 81.9% 87% V5 (many diffs) n/a
3 TRCN0000466141 GTACTTAGTCCGCCGTTTAACTCA pLX_317 25.5% 81.9% 87% V5 (many diffs) n/a
Download CSV