Transcript: Mouse XM_006503972.3

PREDICTED: Mus musculus protein phosphatase 2, regulatory subunit B, gamma (Ppp2r2c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r2c (269643)
Length:
3945
CDS:
208..1509

Additional Resources:

NCBI RefSeq record:
XM_006503972.3
NBCI Gene record:
Ppp2r2c (269643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081055 CCAGGGTGAGTACGATGTATA pLKO.1 354 CDS 100% 13.200 18.480 N Ppp2r2c n/a
2 TRCN0000081056 GATCGGAGCTTCAACATTGTA pLKO.1 778 CDS 100% 5.625 3.938 N Ppp2r2c n/a
3 TRCN0000081053 CCCTCTTGTAAAGAAGTTGAA pLKO.1 3165 3UTR 100% 4.950 3.465 N Ppp2r2c n/a
4 TRCN0000081057 CAAGTTTGAGTGTGCCTGGAA pLKO.1 1185 CDS 100% 2.640 1.848 N Ppp2r2c n/a
5 TRCN0000081054 GCTGAGAATATCATTGCCATT pLKO.1 1432 CDS 100% 4.050 2.430 N Ppp2r2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503972.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11051 pDONR223 100% 89% 97% None (many diffs) n/a
2 ccsbBroad304_11051 pLX_304 0% 89% 97% V5 (many diffs) n/a
3 TRCN0000480089 TCTGATCCGACTCTATAAGCTTCA pLX_317 30.3% 89% 97% V5 (many diffs) n/a
Download CSV