Transcript: Mouse XM_006504058.2

PREDICTED: Mus musculus phosphoglucomutase 1 (Pgm1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pgm1 (66681)
Length:
1981
CDS:
147..1505

Additional Resources:

NCBI RefSeq record:
XM_006504058.2
NBCI Gene record:
Pgm1 (66681)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247389 CCAGTACTGGATAGGATTAAA pLKO_005 1512 3UTR 100% 15.000 21.000 N Pgm1 n/a
2 TRCN0000247385 TGGAGTACGGCTATCATATTA pLKO_005 1075 CDS 100% 15.000 21.000 N Pgm1 n/a
3 TRCN0000247386 CCATCGGTAATGACTACTTTG pLKO_005 337 CDS 100% 10.800 15.120 N Pgm1 n/a
4 TRCN0000247388 TGATCACTGCCTCGCACAATC pLKO_005 148 CDS 100% 10.800 8.640 N Pgm1 n/a
5 TRCN0000192366 CCAACTGTCAAATACCCGAAT pLKO.1 531 CDS 100% 4.050 2.835 N Pgm1 n/a
6 TRCN0000191633 GCTATCATATTACCACAGCTT pLKO.1 1084 CDS 100% 2.640 1.848 N Pgm1 n/a
7 TRCN0000193054 CAGCTCTATCTTCCTTGTGAT pLKO.1 1627 3UTR 100% 4.950 2.970 N Pgm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504058.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14195 pDONR223 100% 63.8% .4% None (many diffs) n/a
2 ccsbBroad304_14195 pLX_304 0% 63.8% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475172 ACAATCGTATCATGACCATCTACC pLX_317 26.8% 63.8% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV