Transcript: Mouse XM_006504065.2

PREDICTED: Mus musculus TBC1 domain family, member 19 (Tbc1d19), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d19 (67249)
Length:
7599
CDS:
483..1784

Additional Resources:

NCBI RefSeq record:
XM_006504065.2
NBCI Gene record:
Tbc1d19 (67249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345514 CAACCACTTCGGATATCATTT pLKO_005 1518 CDS 100% 13.200 18.480 N Tbc1d19 n/a
2 TRCN0000174301 CCCTGAATTGAAAGAATGCTT pLKO.1 785 CDS 100% 3.000 4.200 N Tbc1d19 n/a
3 TRCN0000175021 GCAAGCAATGATGATTACTAT pLKO.1 1110 CDS 100% 5.625 4.500 N Tbc1d19 n/a
4 TRCN0000174278 CCTGAGGATATCCTGTATTAT pLKO.1 1014 CDS 100% 15.000 10.500 N Tbc1d19 n/a
5 TRCN0000345579 CCTGAGGATATCCTGTATTAT pLKO_005 1014 CDS 100% 15.000 10.500 N Tbc1d19 n/a
6 TRCN0000345581 GAACGGATGAGCCAGATTTAA pLKO_005 622 CDS 100% 15.000 10.500 N Tbc1d19 n/a
7 TRCN0000345515 CATGTTCCCTCCTCCGTTAAA pLKO_005 1893 3UTR 100% 13.200 9.240 N Tbc1d19 n/a
8 TRCN0000193086 CGAATCACTCAAAGAAGATAT pLKO.1 210 5UTR 100% 13.200 9.240 N Tbc1d19 n/a
9 TRCN0000193212 CCTGAATTGAAAGAATGCTTT pLKO.1 786 CDS 100% 4.950 3.465 N Tbc1d19 n/a
10 TRCN0000174927 GAAGTCATACATCAGAGGAAA pLKO.1 1226 CDS 100% 4.950 3.465 N Tbc1d19 n/a
11 TRCN0000194026 GAGCAGAAAGAGCTTCTCAAT pLKO.1 585 CDS 100% 4.950 3.465 N Tbc1d19 n/a
12 TRCN0000174762 GAGCTTCTCAATAAGTGGAAT pLKO.1 594 CDS 100% 4.950 3.465 N Tbc1d19 n/a
13 TRCN0000174494 CCAGAATTAAACTTTGCACAT pLKO.1 1858 3UTR 100% 4.050 2.835 N Tbc1d19 n/a
14 TRCN0000175929 GCTACAGATCAACTCTTGCTT pLKO.1 1572 CDS 100% 3.000 2.100 N Tbc1d19 n/a
15 TRCN0000345580 GCTACAGATCAACTCTTGCTT pLKO_005 1572 CDS 100% 3.000 2.100 N Tbc1d19 n/a
16 TRCN0000130773 GCAGCTTAAGACCAATGTGAT pLKO.1 1037 CDS 100% 4.950 2.970 N TBC1D19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504065.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03575 pDONR223 100% 75.5% 80.7% None (many diffs) n/a
2 ccsbBroad304_03575 pLX_304 0% 75.5% 80.7% V5 (many diffs) n/a
3 TRCN0000468467 CTCAGGGATCCCTAGTAACATTCT pLX_317 27.5% 75.5% 80.7% V5 (many diffs) n/a
Download CSV