Transcript: Mouse XM_006504269.2

PREDICTED: Mus musculus ubiquitin specific peptidase 46 (Usp46), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp46 (69727)
Length:
4383
CDS:
321..1073

Additional Resources:

NCBI RefSeq record:
XM_006504269.2
NBCI Gene record:
Usp46 (69727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087216 GCATTACATCACCATCGTAAA pLKO.1 908 CDS 100% 10.800 15.120 N Usp46 n/a
2 TRCN0000022402 GCTAAACACTATTGCGGACAT pLKO.1 356 CDS 100% 4.050 5.670 N USP46 n/a
3 TRCN0000315060 GCTAAACACTATTGCGGACAT pLKO_005 356 CDS 100% 4.050 5.670 N USP46 n/a
4 TRCN0000087213 CCCTCCATGAAGCATATTTAT pLKO.1 2848 3UTR 100% 15.000 10.500 N Usp46 n/a
5 TRCN0000087215 GCTCACGAGTTCTTAAATTAT pLKO.1 333 CDS 100% 15.000 10.500 N Usp46 n/a
6 TRCN0000087214 GCCGAGAACAATAAGCCAGAA pLKO.1 444 CDS 100% 4.050 2.835 N Usp46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08876 pDONR223 100% 62.9% 68.3% None (many diffs) n/a
2 ccsbBroad304_08876 pLX_304 0% 62.9% 68.3% V5 (many diffs) n/a
3 TRCN0000481093 AAGTTCAGCCCTGAACCCGCATGT pLX_317 43.7% 62.9% 68.3% V5 (many diffs) n/a
Download CSV