Construct: ORF TRCN0000481093
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003265.1_s317c1
- Derived from:
- ccsbBroadEn_08876
- DNA Barcode:
- AAGTTCAGCCCTGAACCCGCATGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP46 (64854)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481093
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64854 | USP46 | ubiquitin specific peptidas... | NM_022832.4 | 99.9% | 100% | 1098G>A |
| 2 | human | 64854 | USP46 | ubiquitin specific peptidas... | NM_001134223.2 | 97.5% | 96.9% | (many diffs) |
| 3 | human | 64854 | USP46 | ubiquitin specific peptidas... | NM_001286767.2 | 96.6% | 96.7% | 117_118ins36;1062G>A |
| 4 | human | 64854 | USP46 | ubiquitin specific peptidas... | XM_017008557.2 | 92.4% | 91.5% | (many diffs) |
| 5 | human | 64854 | USP46 | ubiquitin specific peptidas... | NM_001286768.2 | 60.8% | 59.8% | (many diffs) |
| 6 | mouse | 69727 | Usp46 | ubiquitin specific peptidas... | NM_177561.3 | 93.1% | 100% | (many diffs) |
| 7 | mouse | 69727 | Usp46 | ubiquitin specific peptidas... | XM_006504268.3 | 90.9% | 96.9% | (many diffs) |
| 8 | mouse | 69727 | Usp46 | ubiquitin specific peptidas... | XM_006504269.2 | 62.9% | 68.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1164
- ORF length:
- 1098
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac tgtccgaaac atcgcctcca tctgtaatat gggcaccaat gcctctgctc 121 tggaaaaaga cattggtcca gagcagtttc caatcaatga acactatttc ggattggtca 181 attttggaaa cacatgctac tgtaactccg tgcttcaggc attgtacttc tgccgtccat 241 tccgggagaa tgtgttggca tacaaggccc agcaaaagaa gaaggaaaac ttgctgacgt 301 gcctggcgga ccttttccac agcattgcca cacagaagaa gaaggttggc gtcatcccac 361 caaagaagtt catttcaagg ctgagaaaag agaatgatct ctttgataac tacatgcagc 421 aggatgctca tgaattttta aattatttgc taaacactat tgcggacatc cttcaggagg 481 agaagaaaca ggaaaaacaa aatggaaaat taaaaaatgg caacatgaac gaacctgcgg 541 aaaataataa accagaactc acctgggtcc atgagatttt tcagggaacg cttaccaatg 601 aaactcgatg cttgaactgt gaaactgtta gtagcaaaga tgaagatttt cttgaccttt 661 ctgttgatgt ggagcagaat acatcCATTA CCCACTGTCT AAGAGACTTC AGCAACACAG 721 AAACACTGTG TAGTGAACAA AAATATTATT GTGAAACATG CTGCAGCAAA CAAGAAGCCC 781 AGAAAAGGAT GAGGGTAAAA AAGCTGCCCA TGATCTTGGC CCTGCACCTA AAGCGGTTCA 841 AGTACATGGA GCAGCTGCAC AGATACACCA AGCTGTCTTA CCGTGTGGTC TTCCCTCTGG 901 AACTCCGGCT CTTCAACACC TCCAGTGATG CAGTGAACCT GGACCGCATG TATGACTTGG 961 TTGCGGTGGT CGTTCACTGT GGCAGTGGTC CTAATCGTGG GCATTATATC ACTATTGTGA 1021 AAAGTCACGG CTTCTGGCTT TTGTTTGATG ATGACATTGT AGAGAAAATA GATGCTCAAG 1081 CTATTGAAGA ATTCTATGGC CTGACGTCAG ATATATCAAA AAATTCAGAA TCTGGATATA 1141 TTTTATTCTA TCAGTCAAGA GAATACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1201 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1261 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA AGTTCAGCCC 1321 TGAACCCGCA TGTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1381 att