Transcript: Mouse XM_006504341.3

PREDICTED: Mus musculus argininosuccinate lyase (Asl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asl (109900)
Length:
1615
CDS:
163..1557

Additional Resources:

NCBI RefSeq record:
XM_006504341.3
NBCI Gene record:
Asl (109900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504341.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120118 GCAGATTCATCGTGAGAACAT pLKO.1 1221 CDS 100% 4.950 6.930 N Asl n/a
2 TRCN0000120119 GAAGTGTCTGACACCATGATA pLKO.1 1162 CDS 100% 5.625 3.938 N Asl n/a
3 TRCN0000120120 GCCACCAGTGAGAGAGACTTT pLKO.1 856 CDS 100% 4.950 3.465 N Asl n/a
4 TRCN0000120121 CTGAAGGAACTCATCGGTGAA pLKO.1 448 CDS 100% 4.050 2.835 N Asl n/a
5 TRCN0000120117 GCACCTTCAAATTACATCCTA pLKO.1 392 CDS 100% 3.000 2.100 N Asl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504341.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05858 pDONR223 100% 87% 93.7% None (many diffs) n/a
2 ccsbBroad304_05858 pLX_304 0% 87% 93.7% V5 (many diffs) n/a
3 TRCN0000467542 ACTAACTGGAGAACACTGCCTGGG pLX_317 32.7% 87% 93.7% V5 (many diffs) n/a
Download CSV