Transcript: Mouse XM_006504367.2

PREDICTED: Mus musculus calneuron 1 (Caln1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Caln1 (140904)
Length:
8106
CDS:
376..1191

Additional Resources:

NCBI RefSeq record:
XM_006504367.2
NBCI Gene record:
Caln1 (140904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097843 GCTAATATCTCCGTGGAAGAA pLKO.1 622 CDS 100% 4.950 6.930 N Caln1 n/a
2 TRCN0000097844 GATGAATTCATGACGATTCTT pLKO.1 814 CDS 100% 0.000 0.000 N Caln1 n/a
3 TRCN0000097841 CCGGGATCACTTAACGATGAA pLKO.1 963 CDS 100% 4.950 3.465 N Caln1 n/a
4 TRCN0000097842 CAGACAGAGTTTGAAGGAGTT pLKO.1 1045 CDS 100% 4.050 2.835 N Caln1 n/a
5 TRCN0000097840 GCTGAAGTTGACTTCTGGGTT pLKO.1 1645 3UTR 100% 2.640 1.848 N Caln1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6956 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504367.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09107 pDONR223 100% 72.5% 80.4% None (many diffs) n/a
2 ccsbBroad304_09107 pLX_304 0% 72.5% 80.4% V5 (many diffs) n/a
3 TRCN0000468006 AAACCTCACGATCATTTTAAGGGT pLX_317 57.9% 72.5% 80.4% V5 (many diffs) n/a
Download CSV