Transcript: Mouse XM_006504490.2

PREDICTED: Mus musculus Shwachman-Bodian-Diamond syndrome homolog (human) (Sbds), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sbds (66711)
Length:
1269
CDS:
233..667

Additional Resources:

NCBI RefSeq record:
XM_006504490.2
NBCI Gene record:
Sbds (66711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108588 GCTTCGAAATCGCCTGCTATA pLKO.1 50 5UTR 100% 10.800 15.120 N Sbds n/a
2 TRCN0000316424 GCTTCGAAATCGCCTGCTATA pLKO_005 50 5UTR 100% 10.800 15.120 N Sbds n/a
3 TRCN0000304897 GAGAAATTGATGAGCTAATAA pLKO_005 567 CDS 100% 15.000 10.500 N Sbds n/a
4 TRCN0000108587 GAAGTTCAAGTGTCAGATAAA pLKO.1 188 5UTR 100% 13.200 9.240 N Sbds n/a
5 TRCN0000304898 ACATCCACTACTCCGTGAAAC pLKO_005 330 CDS 100% 10.800 7.560 N Sbds n/a
6 TRCN0000108585 GCCACTTTCCATCTTGTGTTA pLKO.1 766 3UTR 100% 4.950 3.465 N Sbds n/a
7 TRCN0000316425 GCCACTTTCCATCTTGTGTTA pLKO_005 766 3UTR 100% 4.950 3.465 N Sbds n/a
8 TRCN0000108586 GAGAAGTTCAAGTGTCAGATA pLKO.1 186 5UTR 100% 4.950 2.970 N Sbds n/a
9 TRCN0000316346 GAGAAGTTCAAGTGTCAGATA pLKO_005 186 5UTR 100% 4.950 2.970 N Sbds n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03217 pDONR223 100% 48.8% 55.2% None (many diffs) n/a
2 ccsbBroad304_03217 pLX_304 0% 48.8% 55.2% V5 (many diffs) n/a
3 TRCN0000480512 AGAATCAGAGAGGTTAAACAAAAC pLX_317 48% 48.8% 55.2% V5 (many diffs) n/a
Download CSV