Transcript: Mouse XM_006504497.3

PREDICTED: Mus musculus zinc finger, HIT domain containing 1 (Znhit1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Znhit1 (70103)
Length:
795
CDS:
117..593

Additional Resources:

NCBI RefSeq record:
XM_006504497.3
NBCI Gene record:
Znhit1 (70103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190894 CGAGGTGACCACTTTAAACTT pLKO.1 342 CDS 100% 5.625 7.875 N Znhit1 n/a
2 TRCN0000241197 TTTAAACTTCGCTTCCGGAAA pLKO_005 354 CDS 100% 4.050 5.670 N Znhit1 n/a
3 TRCN0000190374 CTTTAAACTTCGCTTCCGGAA pLKO.1 353 CDS 100% 2.160 3.024 N Znhit1 n/a
4 TRCN0000241199 GTCTGAAGTGGACCGTGTAAA pLKO_005 574 CDS 100% 13.200 9.240 N Znhit1 n/a
5 TRCN0000241195 TGGCATCAGGGAGAGAAAGTA pLKO_005 597 3UTR 100% 5.625 3.938 N Znhit1 n/a
6 TRCN0000241198 AGGCATTGGAGAATGACAACT pLKO_005 226 CDS 100% 4.950 3.465 N Znhit1 n/a
7 TRCN0000241196 GGCTACCTCAGTTTGATGATG pLKO_005 289 CDS 100% 4.950 3.465 N Znhit1 n/a
8 TRCN0000161101 GAATGACAACTTCCAGGATGA pLKO.1 236 CDS 100% 4.050 2.835 N ZNHIT1 n/a
9 TRCN0000161467 GAGAATGACAACTTCCAGGAT pLKO.1 234 CDS 100% 2.640 1.848 N ZNHIT1 n/a
10 TRCN0000190469 GATGCAGACACAGGAAAGAAA pLKO.1 309 CDS 100% 5.625 3.375 N Znhit1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504497.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02444 pDONR223 100% 85.2% 91.7% None (many diffs) n/a
2 ccsbBroad304_02444 pLX_304 0% 85.2% 91.7% V5 (many diffs) n/a
3 TRCN0000470999 GGGTACAAGGTCCCCCCTGGCCTT pLX_317 92.5% 85.2% 91.7% V5 (many diffs) n/a
Download CSV