Transcript: Mouse XM_006504632.1

PREDICTED: Mus musculus serrate RNA effector molecule homolog (Arabidopsis) (Srrt), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Srrt (83701)
Length:
3867
CDS:
1799..3745

Additional Resources:

NCBI RefSeq record:
XM_006504632.1
NBCI Gene record:
Srrt (83701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111072 TCCGCAACATAAATGGCATTA pLKO.1 2625 CDS 100% 10.800 15.120 N Srrt n/a
2 TRCN0000111074 GAGGCAGTTAAACGCTACAAT pLKO.1 808 5UTR 100% 5.625 7.875 N Srrt n/a
3 TRCN0000111073 GTCCGCAACATAAATGGCATT pLKO.1 2624 CDS 100% 4.050 5.670 N Srrt n/a
4 TRCN0000111070 GCCATTGTCAAGATGCTAGAT pLKO.1 1850 CDS 100% 4.950 3.960 N Srrt n/a
5 TRCN0000111071 GTGGCGTTCTTCAATAACTTT pLKO.1 3353 CDS 100% 5.625 3.938 N Srrt n/a
6 TRCN0000293723 GACCGCAGTGTTAACATTAAA pLKO_005 2522 CDS 100% 15.000 21.000 N SRRT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14150 pDONR223 100% 64.5% 4% None (many diffs) n/a
2 ccsbBroad304_14150 pLX_304 0% 64.5% 4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471548 CGGTCCTTACCAGCTACAGATTCC pLX_317 17.1% 64.5% 4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV