Transcript: Mouse XM_006504639.3

PREDICTED: Mus musculus actin-like 6B (Actl6b), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Actl6b (83766)
Length:
1594
CDS:
574..1398

Additional Resources:

NCBI RefSeq record:
XM_006504639.3
NBCI Gene record:
Actl6b (83766)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116767 CCTGGCATAACTACATGTGTA pLKO.1 830 CDS 100% 4.950 3.960 N ACTL6B n/a
2 TRCN0000090285 GATCATACCTACAGCAAACAT pLKO.1 399 5UTR 100% 5.625 3.938 N Actl6b n/a
3 TRCN0000090284 ACAGACTTAATCGGGAGCTTT pLKO.1 1193 CDS 100% 4.950 3.465 N Actl6b n/a
4 TRCN0000090287 AGCATCGGCATGTGTGACATT pLKO.1 1078 CDS 100% 4.950 3.465 N Actl6b n/a
5 TRCN0000090286 CTGGCATAACTACATGTGTAA pLKO.1 831 CDS 100% 4.950 3.465 N Actl6b n/a
6 TRCN0000090283 GCAGTACAACATTCCTGCCTT pLKO.1 515 5UTR 100% 2.640 1.848 N Actl6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03302 pDONR223 100% 55.2% 54.7% None (many diffs) n/a
2 ccsbBroad304_03302 pLX_304 0% 55.2% 54.7% V5 (many diffs) n/a
3 TRCN0000478329 ATCGTGTAATAAACAACTTGGTCA pLX_317 25.4% 55.2% 54.7% V5 (many diffs) n/a
Download CSV