Transcript: Mouse XM_006504651.2

PREDICTED: Mus musculus MAD1 mitotic arrest deficient 1-like 1 (Mad1l1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mad1l1 (17120)
Length:
2648
CDS:
82..2235

Additional Resources:

NCBI RefSeq record:
XM_006504651.2
NBCI Gene record:
Mad1l1 (17120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273051 GAGCATGAGCAGAAGATTAAG pLKO_005 739 CDS 100% 13.200 9.240 N Mad1l1 n/a
2 TRCN0000273054 GATGACCAAGCCAGATCATAC pLKO_005 2464 3UTR 100% 10.800 7.560 N Mad1l1 n/a
3 TRCN0000012834 AGCTGAATCTAGCTTCTCATT pLKO.1 1539 CDS 100% 4.950 3.465 N Mad1l1 n/a
4 TRCN0000273052 AGCTGAATCTAGCTTCTCATT pLKO_005 1539 CDS 100% 4.950 3.465 N Mad1l1 n/a
5 TRCN0000012837 CCAGGGAGATGATTAGTTCAT pLKO.1 545 CDS 100% 4.950 3.465 N Mad1l1 n/a
6 TRCN0000012835 GACATGGTTCAGAAGGTACAT pLKO.1 1399 CDS 100% 4.950 3.465 N Mad1l1 n/a
7 TRCN0000012836 CAACTTCATTTCTCAGCGAAT pLKO.1 135 CDS 100% 4.050 2.835 N Mad1l1 n/a
8 TRCN0000273055 CAACTTCATTTCTCAGCGAAT pLKO_005 135 CDS 100% 4.050 2.835 N Mad1l1 n/a
9 TRCN0000012833 CAGACCTCTATCTAGCCTCTT pLKO.1 2221 CDS 100% 4.050 2.835 N Mad1l1 n/a
10 TRCN0000273053 CAGACCTCTATCTAGCCTCTT pLKO_005 2221 CDS 100% 4.050 2.835 N Mad1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.