Transcript: Mouse XM_006504753.3

PREDICTED: Mus musculus monocyte to macrophage differentiation-associated 2 (Mmd2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mmd2 (75104)
Length:
2123
CDS:
416..865

Additional Resources:

NCBI RefSeq record:
XM_006504753.3
NBCI Gene record:
Mmd2 (75104)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101116 CGACAGGATGGTGATCTACTT pLKO.1 442 CDS 100% 4.950 6.930 N Mmd2 n/a
2 TRCN0000101119 GATCGACAGGATGGTGATCTA pLKO.1 439 CDS 100% 4.950 6.930 N Mmd2 n/a
3 TRCN0000101118 CTCTTTGTGGTATCCACCATT pLKO.1 359 5UTR 100% 4.950 3.465 N Mmd2 n/a
4 TRCN0000101115 GCCCTTTCTATGGAGGAGAAA pLKO.1 1036 3UTR 100% 0.495 0.347 N Mmd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14443 pDONR223 100% 53.7% 56.9% None (many diffs) n/a
2 ccsbBroad304_14443 pLX_304 0% 53.7% 56.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000479807 CACGACGGATGCCAAAATTATGAA pLX_317 46.7% 53.7% 56.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV