Transcript: Mouse XM_006504940.3

PREDICTED: Mus musculus mesenteric estrogen dependent adipogenesis (Medag), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Medag (70717)
Length:
2433
CDS:
393..1031

Additional Resources:

NCBI RefSeq record:
XM_006504940.3
NBCI Gene record:
Medag (70717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420723 AGGTAAAGCCAGTACTGATAT pLKO_005 1479 3UTR 100% 13.200 18.480 N Medag n/a
2 TRCN0000201353 GCGTTCAACTTGTAATGGATT pLKO.1 2179 3UTR 100% 4.950 6.930 N Medag n/a
3 TRCN0000421711 GACCAACTACTGTGATTATAA pLKO_005 410 CDS 100% 15.000 12.000 N Medag n/a
4 TRCN0000423432 GACCAACTACTGTGATTATAA pLKO_005 410 CDS 100% 15.000 12.000 N MEDAG n/a
5 TRCN0000190979 CATCGGTTACAGAACCACTTT pLKO.1 949 CDS 100% 4.950 3.960 N Medag n/a
6 TRCN0000191621 GTTTCTCTGATCGGAAATTTA pLKO.1 871 CDS 100% 15.000 10.500 N Medag n/a
7 TRCN0000189998 GAAGAGACATCCAGCCAACTT pLKO.1 1005 CDS 100% 4.950 3.465 N Medag n/a
8 TRCN0000201962 CCAGGAACGATTGTGCTGAAT pLKO.1 657 CDS 100% 4.950 2.970 N Medag n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09243 pDONR223 99.2% 60.2% 63.3% None (many diffs) n/a
2 ccsbBroad304_09243 pLX_304 0% 60.2% 63.3% V5 (many diffs) n/a
3 TRCN0000492051 GACTTTTCTTACCTTTTACAGAAT pLX_317 47.3% 60.2% 63.3% V5 (many diffs) n/a
Download CSV