Transcript: Mouse XM_006504957.2

PREDICTED: Mus musculus HEPACAM family member 2 (Hepacam2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hepacam2 (101202)
Length:
2140
CDS:
35..1429

Additional Resources:

NCBI RefSeq record:
XM_006504957.2
NBCI Gene record:
Hepacam2 (101202)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216252 CTTATGGACTTCAGGTTAATT pLKO.1 762 CDS 100% 15.000 21.000 N Hepacam2 n/a
2 TRCN0000217229 CTTGCTAGGCTCCGTTAATAA pLKO.1 277 CDS 100% 15.000 21.000 N Hepacam2 n/a
3 TRCN0000216251 CTCGATTCACAGTCATCATAA pLKO.1 1023 CDS 100% 13.200 18.480 N Hepacam2 n/a
4 TRCN0000174354 CGGAACAATTTATGAAGTCAT pLKO.1 1369 CDS 100% 4.950 6.930 N Hepacam2 n/a
5 TRCN0000175499 CCTTGGTAGATGTTCGCAATA pLKO.1 1794 3UTR 100% 10.800 7.560 N Hepacam2 n/a
6 TRCN0000193945 CCCTAGTTACTTGCTACTGAA pLKO.1 1681 3UTR 100% 4.950 3.465 N Hepacam2 n/a
7 TRCN0000193563 GCTATAAGACAGAAGCTAGAA pLKO.1 1178 CDS 100% 4.950 3.465 N Hepacam2 n/a
8 TRCN0000175998 GCATCTGACATCCAGATCATA pLKO.1 221 CDS 100% 0.563 0.394 N Hepacam2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09892 pDONR223 100% 82.5% 82.7% None (many diffs) n/a
2 ccsbBroad304_09892 pLX_304 0% 82.5% 82.7% V5 (many diffs) n/a
3 TRCN0000475924 GCTTCAGACGATGTCCCAGACCTA pLX_317 23.8% 82.5% 82.7% V5 (many diffs) n/a
Download CSV