Transcript: Mouse XM_006505998.3

PREDICTED: Mus musculus coiled-coil domain containing 174 (Ccdc174), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc174 (232236)
Length:
2155
CDS:
493..1893

Additional Resources:

NCBI RefSeq record:
XM_006505998.3
NBCI Gene record:
Ccdc174 (232236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216817 GGACATGTACCTTGTGGATTT pLKO.1 813 CDS 100% 10.800 7.560 N Ccdc174 n/a
2 TRCN0000419134 GTGGATTACGTGGACTCTTTG pLKO_005 982 CDS 100% 10.800 7.560 N CCDC174 n/a
3 TRCN0000217199 CAGAGAAAGATGCGGAACAAA pLKO.1 686 CDS 100% 5.625 3.938 N Ccdc174 n/a
4 TRCN0000175466 CCCGAGACAAAGAGTTAAGAA pLKO.1 1256 CDS 100% 5.625 3.938 N Ccdc174 n/a
5 TRCN0000175566 CAAATCGAGGAAGAGAGAGAT pLKO.1 895 CDS 100% 4.950 3.465 N Ccdc174 n/a
6 TRCN0000193235 CAAATTACTTTGTGGGTCAAA pLKO.1 1673 CDS 100% 4.950 3.465 N Ccdc174 n/a
7 TRCN0000175446 CTTTGGATTCTGGTCGAAGAA pLKO.1 1605 CDS 100% 4.950 3.465 N Ccdc174 n/a
8 TRCN0000173330 GAAGTCAGTCAGGACTGAGTT pLKO.1 1927 3UTR 100% 0.495 0.347 N Ccdc174 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11966 pDONR223 100% 66.9% 65.5% None (many diffs) n/a
2 ccsbBroad304_11966 pLX_304 0% 66.9% 65.5% V5 (many diffs) n/a
3 TRCN0000468858 TTAGCCAATTTTATCCTCATCGAC pLX_317 6% 66.9% 65.5% V5 (many diffs) n/a
Download CSV