Transcript: Mouse XM_006506011.1

PREDICTED: Mus musculus vestigial like family member 4 (Vgll4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vgll4 (232334)
Length:
2741
CDS:
352..1197

Additional Resources:

NCBI RefSeq record:
XM_006506011.1
NBCI Gene record:
Vgll4 (232334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265297 GCCTCTTGCCCTGACTAAGAA pLKO_005 741 CDS 100% 5.625 4.500 N Vgll4 n/a
2 TRCN0000250410 ACACATGGCTTCAGATCAAAG pLKO_005 1064 CDS 100% 10.800 7.560 N Vgll4 n/a
3 TRCN0000173136 CCTCTGTGATTACCTGTGCAT pLKO.1 809 CDS 100% 2.640 1.848 N Vgll4 n/a
4 TRCN0000250409 CCTAACTCGGTGTCCATCACT pLKO_005 1006 CDS 100% 3.000 1.800 N Vgll4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07466 pDONR223 100% 84.4% 89.3% None (many diffs) n/a
2 ccsbBroad304_07466 pLX_304 0% 84.4% 89.3% V5 (many diffs) n/a
3 TRCN0000467980 TATGCCTATGACTCGCAAGTTGCG pLX_317 34.3% 84.4% 89.3% V5 (many diffs) n/a
Download CSV